On-target is the proportion of detected RI reference genomes assigned to the target; RI genome sensitivity is the proportion of target RI reference genomes detected.
Primer Species LP RP Tml Tmr Length Score ⇅ On-target ⇅ RI genome sensitivity ⇅
Primer 861 Chlamydia abortus TGGCTTTTGTTTCCCGAGACT CGTAGCCTCCGCTTGCTTA 60.13 59.86 183 0
100.00% Complete
100.00%
100.00% Complete
100.00%